70006 Sigma-AldrichT7SelectDOWN Primer
Recommended Products
Overview
Replacement Information |
---|
Pricing & Availability
Catalog Number | Availability | Packaging | Qty/Pack | Price | Quantity | |
---|---|---|---|---|---|---|
70006-3 |
|
Plastic ampoule | 500 pmol |
|
— |
References |
---|
Product Information | |
---|---|
Oligo seqence | 5ʹ - AACCCCTCAAGACCCGTTTA - 3ʹ |
Quality Level | MQ100 |
Applications |
---|
Biological Information |
---|
Physicochemical Information |
---|
Dimensions |
---|
Materials Information |
---|
Toxicological Information |
---|
Safety Information according to GHS |
---|
Safety Information |
---|
Product Usage Statements |
---|
Storage and Shipping Information | |
---|---|
Ship Code | Shipped with Blue Ice or with Dry Ice |
Toxicity | Standard Handling |
Storage | -20°C |
Avoid freeze/thaw | Avoid freeze/thaw |
Do not freeze | Ok to freeze |
Packaging Information |
---|
Transport Information |
---|
Supplemental Information |
---|
Specifications |
---|
Global Trade Item Number | |
---|---|
Catalog Number | GTIN |
70006-3 | 04055977273854 |
Documentation
T7SelectDOWN Primer SDS
Title |
---|
T7SelectDOWN Primer Certificates of Analysis
Title | Lot Number |
---|---|
70006 |
Citations
Title | |
---|---|
|